DEATH FIST bol jeden z prvých xeroxovýh fanzinov na Slovensku venujúc sa extrémnej muzike. Vznikol v roku 1991 a pravidelne a nepravidelne aj s prestávkami vychádzal až do roku 2005, keď jeho existencia bola nadobro ukončená. Tu bola obnovená jeho činnosť vo forme blogu. Túto stránku ,robia fanúškovia hudby, ktorý si recenzované produkty kupujú sami! Nie sme viazaný žiadnym dlhom voči vydavateľom a kapelám.

sobota 29. júna 2013

ANTIGAMA "Meteor" CD 2013 (Selfmadegod Records)

Poliakom ANTIGAMA už na ich EP "Athems" sa diali zaujímavé veci, ktoré naznačovali že ich ďalší album, bude viac než zaujímavý. Veru je aj tak. Antigama vždy sa radi hrali s melodiami, riffmi a vždy posúvali niekde svoj grindcore do prebádaných aj neprebádaných vôd. Tak isto ich novinka je obdarená poriadnou dávkou progresivity, netradičných postupov. Základom zostáva grindcore, na ktorý sa nabalujú ostatné, dosť netradičné postupy. Ich grindcore má najbližšie práve k Napalm Death a občas táto nahrávka pripomína, experimentálne obdobie tejto kapely, pri albumoch "Diatribes".
Občas zase vám to zavonia americkým grindcore, občas začujete zaujímavé electro/noise postupy, proste správny guláš.Až ste otvorený, rôzným štýlovým kotrmelcom, netradičným postupom, tak sa tu vybláznite dosýta. Čo je však na celej nahrávke to najzaujímavejšie, tak je to fakt, že sa to strašne dobre počúva a kapela sa nestráca v onanii vlastných riffov, ako sa to stáva viacerým kapelám v tomto štýle. Má to spár, má to gule, nenudí to a ukáže vám to niečo neošúchané! Dobrá práca!

piatok 28. júna 2013

GRINNED "Grin and Bear It ! " CD 2013 (Bizzare Leprous Productions)

Írsko/České zoskupenie GRINNED je premňa absolútnou neznámou. Sú to nováčkovia na scéne, ale len menom, lebo tu najdete imigranta z Čiech, ktorý predtým brúsil v kapele Mincing Fury a aj ostatný členovia, už majú za sebou pár kapiel.Takže, ako štartovné už by bolo. Očakávam nápisy na cd "ex-Mincing Fury" ale naštastie sa nič nedeje! Ale ako hosťa tu najdete ďalšieho Čecha Topiho, vokalistu Pigsty ,ako vypomôže v jednej skladbe. Ale to len tak na okraj -) O.k., vrhnime sa na muziku. Po disharmonickom intre sa na vás vrhne grindcore, ale v trocha netradičnej forme. Chlapci sa rozhodli, že si nebudú stavať mantinely a použijú všetky dostupné materiály, ktoré sa už v grindcore objavujú. Čo to znamená? Do typického grindcore primiešali celkom dosť HC postupov a napr. skladba "104" je typická HC hajlákačka se vším všudy. No a napríklad posledná skladba "No Jobs, No Hope..." je čistá rock ´n ´rollová záležitosť so sólom na koniec, ktoré tam znie, ako keby dotyčný gitarista ani nepočul, čo znie pod tým sólom -))) Medzi týmito výčnielkami je to poriande vypchaté grindcore masážou, ako sa patrí. Minutové blasty , občas Heamorrhage vokál, proste taký mix všetkého, čo máme radi v tejto muzike. Hudba ako celok a to je zaujímavé, nelezie tak pod kožu na prvé vypočutie. Mne osobne trvalo asi týždeň, keď som sa začal orientovať v skladbách, ale to je bežná choroba v tomto štýle. Veľa songov, pomalé chápanie. Ako debut je to celkom slušná úroveň, ale ja tvrdím vždy, že až druhý album vždy odhalí pravú tvár kapely. Som zvedavý!!

utorok 25. júna 2013

NEW YORK AGAINST THE BELZEBU "Se Voce Quer Barullmo...Toma! " flexi 7"EP (Dismantle Records)

Toto flexi je limitované na 100 ks a moje číslo je 13 - dobrý začiatok. Prvá skladba  " Som de teste " má čas 0:00 - ešte lepšie. Hudobne v skratke a rukolapne: Guaraaanáááááááá, úúúáááárrrgghhhh ááááá tddddddds!!!! pičúúúúúúúláááááááá uááááá bbblééééééééáuáággghhh .....uauauááá tds! uááááuááááuáááá  dsdsdstds!... atď. Brazílci NYATB nie sú žiadne nové slečinky na scéne, mrvia rožky už pekných pár rokov, mám (pozerám discogs ... ) takých 50% ich matrošu, ale hneď priznávam, že to v hlave nemám nijak extra uložené, že to proste nie je žiadna moja srdcovka, ale toto, toto je moc dobrá vec! Noisecore klasika od podlahy, sic nič nové ale sranda a nadhľad určite, aj to flexi na kráse zvuku tak nejak v dobrom nepridá, no proste jebanica ortodoxná a páči sa mi to. Vagabúúúúndo, ekulááááádá ... tagatagatagatagataga ... a pecka obal, tiež v klasických noisecore náladách, to mám rád. Dobrá vec, na masové ušné plienenie po kanceláriách,  úradoch a podobnýh prijebaných uzavretých miestnostiach ako stvorené. 

piatok 21. júna 2013


Celkom sympatické splitko dvoch mladých kapiel zo Slovenska, šírené na finančné možnosti na Slovensku, ako CDr-ko s textami a s obalom, ktorý som nejak nepochopil, alebo len zle vyložil, neviem.Priložená je aj prosba o kopírovanie a ďalšie šírenie. Takto by to malo byť. No pome na nich! DISENT hrajú taký mix punk/crust rytmov, metalových riffov a  až grindcore vokálu. Ja to taký recept, ktorý nie každému možno sadne, ale na koncertoch toto musí zaberať na 100%. Vadí mi trocha monotónosť vokálu, na ktorom keby sa zapracovalo, tak by to bolo fakt 100%-né, ale toto je len fakt môj subjektívny pohľad. Zvuk je obstaraný na slušnej úrovni (Vomitor sound) a celkovo 11 skladieb, je celkom slušná nakládačka. Slušné!  BASAL BANAR je už hudobne niekde inde. Muzika je taký crust/fast mix ale gitarista asi celkom huste počúva Sepulturu, lebo z jeho riffov to kričí na kilometre a predpokladám coverka od Sepultury "Troops Of Doom" tu asi nie je náhodou. Celú muziku ale zahusťuje na až prasopalnú úroveň, práve vokál. Na koncerte som videl dva vokály, ale tuto počujem len jeden ženský (možno sú to dva na jednej úrovni), ale za to o to intenzívnejší. Zvuk je o niečo špinavší, ale to len pridáva na tejto muzike. Kvalitka na intenzívnej úrovni. Podporte aj vy tieto dve kapely, až na toto CDr natrafíte.

utorok 18. júna 2013

RADIATION "Promo Tape" 2013 Kazeta

Boha toto je ultra retro ako remeň! Toto ma katapultovalo na začiatok 90tych rokov, keď som sral z každej Sodom nahrávky, CDčka sme nepoznali, alebo na ne nemali, tak všetko bolo zásadne na kazetách. Bratislavský RADIATION (kapela s podobným menom existuje aj vo Švédsku a aj hrajú podobne),sa rozhodli každému pripomenúť, ako to vyzeralo pri koreňoch. Ukázali naždému, úplné semiačko thrash metalového stromu, kde už teraz ako dobre vieme , jej vetvy sú odhnité a kyselé, ale toto chutí skvele. Nechápem to, že počúvam nový Sodom a vypínam to po druhej skladbe a naopak táto kazeta mi fičí doma už druhý deň v kuse. Ja aj viem prečo. Chlapci majú v sebe ešte poriadnu dávku agresivity, energie ahlavne chuti to hrať. Nejedná sa pritom o žiadnych starých bardov, ale mladých nadšencov. Na túto kazetu narvali 5 skladieb v úplne retro Sodom štýle, nashraté u kamaráta Vomitor Sound štúdio. Na margo zvuku. Táto nahrávka je asi zo všetkých Vomitor nahrávok, tá najšpinavšie znejúca, to znamená, že mne sa páči najviac! Ja tomuto nemám ani čo vytknúť, lebo chlapci mi brnkli na strunu, ako nevládnému dôchodcovi Kazík v domove dôchodcov! Paráda! Thrash to thrash!!!!

utorok 11. júna 2013

FEASTEM "Avaritia Humanae" CD 2013 (Obscene Productions)

Finský FEASTEM boli vždy známi, že tlačia intenzívny grindcore . Novinka sa tiež nesie v ich už typickom zvyku, že za pár minút narveme do ludí toľko energie, že im to bude vytekať každý otvorom, ktorým ich príroda obdarila! Pri tejto novinke sa už nemôžem ubrániť prirovnaniu (ba až kopírke) Rotten Sound. prečo? Idú na to rovnakým spôsobom. Vezmite si vysokovýkonného bubeníka, ktorý fičí na metronome a doma na večeru žerie Singerky. Dajte k tomu gitary zbustrované do polohy vysávača pred odchodom do kremíkového neba, urevaný, ba až občas nariekavý vokál (ako keby sa im prosil, aby spomalili) a všetko to vytuningujte na také obrátky, za ktoré by sa ani nehabili ani v NASA a máte to. Áno bude vám to od začiatku pripomínať spomínaných Rotten Sound a to vďaka tomu, že používajú (vykrádajú) ten istý vzor a tým je starý Napalm Death. Ale všetko ide tak pekne schovať pod ten severský zvuk, že to občas fakt nepostrehnete. Táto novinka na rozdiel od dva roky starého predchodcu "World Delirium" je o moc chytľavejšia a neznie to už ako bezduché závody o to kto bude prvý vo Valhalle. Parádna nahrávka a musím sa priznať po dlhom čase asi jediná, čo mi zo Škandinávskej grindcore školy , zase sadla na 100%. Paráda!!!

pondelok 10. júna 2013


 Je nedeľa poobede. Mám za sebou niekoľko hodín spánku, v hlave mi stále hučí a cítim sa čerstvý ako saláma v tescu. Tento večer sa naplnili všetky predpoklady na poriadny výpek a test vlastnej psychiky, no ale pekne poporiadku....Motorest Dubník neni len tak obyčajný motorest, ale čas od času sa jeho základy poriadne zatrasú a jeho priestory sú na jeden víkend obsadené kreatúrami, ktoré sú na míle vzdialený od bežných zákazníkov aký sa tu bežne zastavia po ceste na obed, alebo kávu. Tento krát bola dôvodom tohto kultúrne podujatia oslava jubilea našeho kamaráta a známeho žiarskeho metalového pekelníka a vypekača Pištu. Všetko sa odohralo pod názvom U!! fest, stretnutie primátov a môžete mi veriť, že to tak skutočne aj vyzeralo. Na miesto 
Sedem Minut Strachu
 činu prichádzame s mojou milou a Radom vo vopred dohodnutý čas. Tu už nachádzame tretieho člena našeho obskúrneho hlučného telesa Riša aj s ostatnými kumpánmi. Nasledujú gratulácie oslávencovi, rozkladanie bicích, aparátu a príchody ďalších známych postavičiek. Naplánovaný čas začiatku sa samozrejme nedodržuje a so Sedem Minút Strachu to naplno rozbaľujeme až okolo pol deviatej. Na dnes sme Pištovi pripravili špeciálny set v duchu U!!, primitívny rachot neandrtálskeho charakteru. Uvolnenie, extáza, orgasmus. Balíme a prenechávame priestor bigbítovej žiarskej legende ZPP band, čo boli páni okolo päťdesiatky a ich hudba nielen mne 
 pripomínala Pražský Výber. Možno si mnohý mysleli, že sa sem štýlovo moc nehodili, no v časoch, keď boli páni v našom veku to bola tiež podobná forma rebélie, underground a túžba byť iný ako ostatný. Ich hudba znela fajn a bolo z nich cítiť, že to čo robia ich baví. Ochutnávame guláš, bravčový a aj sójový, obidva chutili výborne a plníme tak brušiská do prasknutia. Medzitým to rozbaľuje všetkým grinderom dobré známe trio Mindfuck. Rýchlosť na plné obrátky, prasopal jak sviňa. Grind šleha na jednu gitaru, pomedzi songy nonstop píska väzba a hukot ani na chvílu nepoľavuje. Hlučný útok na sluchovody, totálna deštrukcia, prsty sú hore. Radiation 
 z blavy priviali vietor 80-tych rokov v podobe oldschool trash metalu. Tu neni o čom pochybovať. Chalani sa v tomto štýle našli a všetko počnúc image a končiac totálnym hudobným peklom im verím. Toto neni pózerstvo, ale úprimnosť a nadšenie. Som nesmierne rád, že sa stále nájdu mladý ľudia, ktorí nepodľahnú trendom a drvia poctivý metal a nie moderný zasraný metalcore. Výborný set so všetkým čo k tomu patrí. Ľudia vo vnútri a hlavne pán oslávenec sa už výborne bavia a nálada rapídne stúpa. Po nich sa na „pódium“ tlačí dvojmetrový obor Lepra, muž ktorý pre slovenskú grind scénu robí neskutočne veľa a s ním ďalšie trio večera  
 Abortion. Túto bandu som videl asi milión krát, no oni jednoducho nemôžu sklamať. Od prvého úderu do strún a činelov sa ide na plné obrátky, lepra reve ako psychopat pri elektrošokoch a s prehľadom dávajú jeden song za druhým. Mirči drží paličky pevne v rukách a vidno, že hranie s potratmi si poriadne užíva. Všetci čo sú dnu hulákajú spolu s kapelou chytľavé refrény „bomby na nitru“, alebo „heavy mental“ a samozrejme nesmie chýbať známi sekundový cover od napalmovej smrti. Pomedzi skladby sa dobíjajú dúškami Jacka Danielsa a všetko má pod kontrolou ich manažér hehe. Prichádza čas na zahraničného hosťa, Morkhimel. Pražáci 
 rozpútali apokalyptické peklo a všetci čo sú ešte živý hrozia a metajú sa pred kapelou. Kombinácia temného severského metalu s príchuťou punku má neuveriteľnú silu a pre väčšinu boli práve oni dnešným vrcholom večera. Všetci sú vo vytržení a Slávek dokonca končí nad hlavami ostatných sediac na stoličke. Spokojnosť na tvárach podguráženého osadenstva a premena na primáty je už v pokročilom štádiu. Ako predposledný band sú na poslednú chvíľu vybavený Basal Banar zo Zvolena, ktorý sa tu zastavili po ceste z koncertu v Šali ako náhrada za Wynston Smith, ktorý boli náhrada za Mä kurva, neni toto už nejaké komplikované??? 
 Nevadí....Jednoznačne si zaslúžia rešpekt. Odohrať dva koncerty za večer, z toho ten druhý okolo tretej ráno dá určite zabrať na psychiku. Popasovali sa s tým bravúrne a odohrali výborný energický set. Kubo s Majčou vrieskajú ostatným rovno ksichtu a v kotli končí aj sám majster hluku Bibo. Na záver čerešnička na torte a hlučný pozdrav od najhlučnejšej rodiny na u nás, Supraphon Family. Marek s Jankou sú nahodený v bizarných maskách vytvárajú totálnu zmes hluku, kvílenia a industriálneho rachotu za pomoci pílky, vysávača, lieviku na chobote Marekovej masky a podobných úletov. Toto sa veľmi ťažko opisuje, to jednoducho treba 
 vidieť naživo. Na konci sa k nim pripojil aj sám Pišta a ukončili tak tento večer. Vonku je už vidno, a tí čo ešte žijú, vyzerajú ako zo seriálu Walking Dead. Kecáme ešte o kravinách, rehoceme sa ako dementi na všetkom a proste všetko čo sa tu v tomto čase deje nemá nič spoločné zo zdravým rozumom. Do stanu sa dostávame okolo šiestej no ranné slnko nám veľa spánku nedopraje. Všade po areáli niekto polihuje, či už na tráve, v stane alebo v aute, všade len mŕtve telá bez reakcie. Motorest je už našťastie otvorený a tak dávame zelený čaj, vybavujeme si zážitky z večera a snažím sa triezvieť a pripravovať sa na cestu domov. Čo k tomuto dodať na záver....dubník opäť nesklamal, aj keď návštevnosťou to bolo oproti minulým trochu slabšie. Bolo skvelé stretnúť starých známych, nikam sa neponáhľať, oddýchnuť si a vypadnúť z bežnej reality. Teším sa ďalšie podobné akcie.
-Jan IP-  (Fotky Pišta Jalapeňos)

piatok 7. júna 2013

ŠKODA 120 "Samorost" LP 2013 (Kooperácia)

Aj keď sme už o tomto matroší písali tu na stránkách Death fistu a Zbyňa nám všetko vysvetlil, tak medzi tým ubehol jeden rok a na scéne je aj vinylová verzia tochto albumu. Zaujímavosťou je, že celý materiál "Samorost" sa vošiel na A. stranu a na B. strane najdete koncert kapely s klasickým nastrihnutým standing ovation -)) Až ste neregistrovali tento matroš, alebo ste len obyčajný vynilomaniak, tak tu dostanete poriadnu dávku grindcore alá Česká republika, excellentný booklet  a hlavne poriadnu minutáž. Takto nejak si predstavujem využitie LP na 100%. Tomuto nie je ani čo vytknúť. Podporte ich aj vy!!